BEST Bayesian
Category
Bioinformatics
Program On
zcluster
Version
2.3.1
Author / Distributor
Description
BLAST (Basic Local Alignment Search Tool), more details at NCBI
Running Program
BEST is a free phylogenetics program to estimate the joint posterior distribution of gene trees and species tree using multilocus molecular data that accounts for deep coalescence but not for other issues such as horizontal transfer or gene duplication.
This code works as a modification of the popular phylogenetics software package
mbbest, /usr/local/BEST/latest/mbbest are always pointed to the latest update version.
Version: /usr/local/BEST/2.3.1/mbbest /usr/local/BEST/2.2/mbbest
Example of interactive program. Please refer to here about running jobs at interactive nodes.
ssh -Y inter2 mbbest ... exit
When running MPI jobs on the rcluster interactive node (inter2), please first create a file host.list. Refer to Running an Interactive Job for details about host.list. The host.file will as:
inter2 inter2 inter2 inter2
Then run the mpirun command with:
ssh -Y inter2 mpirun -np 2 -machinefile host.list mbbest
Where the "2" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.
To quit the program, type q and ENTER
Run the job in the queue, also refer to submit jobs to queues at rcluster, IOB
Below is an example file defines the data. Save this file as e.x. yh.nex
cp /usr/local/mrbayes/primates.nex yh.nex
Content of yh.nex is:
#NEXUS begin data; dimensions ntax=12 nchar=898; format datatype=dna interleave=no gap=-; matrix Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATTTTGC TACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAACATGA .... end;
Define all the parameters in the .par file, e.x. yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.
set autoclose=yes nowarn=yes; execute yh.nex; lset nst=6 rates=gamma; mcmc nruns=1 ngen=10000 samplefreq=10 file=yh.nex1; mcmc file=yh.nex2; mcmc file=yh.nex3;
Below is a script subp.sh to the batch queue, yh.par is the file definced above
#!/bin/bash cd my-working-dir echo $LSB_HOSTS cat /dev/null > mlist.$$ for variable in $LSB_HOSTS; do echo $variable >> mlist.$$ done mpirun -np 2 -machinefile mlist.$$ /usr/local/BEST/latest/mbbest < yh.par > myout rm -f mlist.$$ x
After saved the subp.sh, use following add excute permission to the subp.sh
chmod u+x subp.sh
Then submit all these to the queue as
bsub -n 2 -q rcc-r32-30d -o mbbtest.out.%J -e mbbtest.err.%J ./subp.sh
the -n 2 is number of processors for teh MPIRUN, it has to be matched with the number of processors (-np) in the subp.sh. If you are using mri/iob queue, the number could be set as 4.
Documentation
Online tutorial available at BEST website.
Commands that are available from the command
line or from a MrBayes block include:
About -- Describes the program
Acknowledgments -- Shows program acknowledgments
Charset -- Assigns a group of sites to a set
Charstat -- Shows status of characters
Citations -- Appropriate citation of program
Comparetree -- Compares the trees from two tree files
Constraint -- Defines a constraint on tree topology
Ctype -- Assigns ordering for the characters
Databreaks -- Defines nucleotide pairs (doublets) for stem models
Delete -- Deletes taxa from the analysis
Deroot -- Deroots user tree
Disclaimer -- Describes program disclaimer
Exclude -- Excludes sites from the analysis
Execute -- Executes a file
Help -- Provides detailed description of commands
Include -- Includes sites
Link -- Links parameters across character partitions
Log -- Logs screen output to a file
Lset -- Sets the parameters of the likelihood model
Manual -- Prints a command reference to a text file
Mcmc -- Starts Markov chain Monte Carlo analysis
Mcmcp -- Sets the parameters of a chain (without starting analysis)
Outgroup -- Changes outgroup taxon
Pairs -- Defines nucleotide pairs (doublets) for stem models
Partition -- Assigns a character partition
Plot -- Plots parameters from MCMC analysis
Prset -- Sets the priors for the parameters
Props -- Set proposal probabilities
Quit -- Quits the program
Report -- Controls how model parameters are reported
Restore -- Restores taxa
Root -- Roots user tree
Set -- Sets run conditions and defines active data partition
Showmatrix -- Shows current character matrix
Showmodel -- Shows model settings
Showtree -- Shows user tree
Sump -- Summarizes parameters from MCMC analysis
Sumt -- Summarizes trees from MCMC analysis
Taxastat -- Shows status of taxa
Taxset -- Assigns a group of taxa to a set
Unlink -- Unlinks parameters across character partitions
Usertree -- Defines a single user tree
Version -- Shows program version
Commands that should be in a NEXUS file (data
block or trees block) include:
Begin -- Denotes beginning of block in file
Dimensions -- Defines size of character matrix
End -- Denotes end of a block in file
Endblock -- Alternative way of denoting end of a block
Format -- Defines character format in data block
Matrix -- Defines matrix of characters in data block
Translate -- Defines alternative names for taxa
Tree -- Defines a tree from MCMC analysis
Note that this program supports the use of the shortest unambiguous
spelling of the above commands (e.g., "exe" instead of "execute").
Installation
Source downloaded from BEST website.
System
64-bit Linux