BEST Bayesian

Category

Bioinformatics

Program On

zcluster

Version

2.3.1

Author / Distributor

Liang Liu

Description

BEST website

Running Program

BEST is a free phylogenetics program to estimate the joint posterior distribution of gene trees and species tree using multilocus molecular data that accounts for deep coalescence but not for other issues such as horizontal transfer or gene duplication.

This code works as a modification of the popular phylogenetics software package MrBayes

mbbest, /usr/local/BEST/latest/mbbest are always pointed to the latest update version.

Version: /usr/local/BEST/2.3.1/mbbest /usr/local/BEST/2.2/mbbest

Example of interactive program. Please refer to here about running jobs at interactive nodes.

ssh -Y inter2
mbbest
...
exit

When running MPI jobs on the rcluster interactive node (inter2), please first create a file host.list. Refer to Running an Interactive Job for details about host.list. The host.file will as:

inter2
inter2
inter2
inter2

Then run the mpirun command with:

ssh -Y inter2
mpirun -np 2 -machinefile host.list mbbest

Where the "2" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job. Then follow the instruction on the screen. To quit the program, type q and ENTER Run the job in the queue, also refer to submit jobs to queues at rcluster, IOB Below is an example file defines the data. Save this file as e.x. yh.nex

cp /usr/local/mrbayes/primates.nex yh.nex

Content of yh.nex is:

#NEXUS
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATTTTGC
TACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAACATGA
.... 
end;

Define all the parameters in the .par file, e.x. yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.

set autoclose=yes nowarn=yes;
execute yh.nex;
lset nst=6 rates=gamma;
mcmc nruns=1 ngen=10000 samplefreq=10 file=yh.nex1;
mcmc file=yh.nex2;
mcmc file=yh.nex3;

Below is a script subp.sh to the batch queue, yh.par is the file definced above

#!/bin/bash
cd my-working-dir
echo $LSB_HOSTS
cat /dev/null > mlist.$$
for variable in $LSB_HOSTS; do
echo $variable >> mlist.$$ 
done
mpirun -np 2 -machinefile mlist.$$ /usr/local/BEST/latest/mbbest < yh.par > myout
rm -f mlist.$$
x

After saved the subp.sh, use following add excute permission to the subp.sh

chmod u+x subp.sh

Then submit all these to the queue as

bsub -n 2 -q rcc-r32-30d -o mbbtest.out.%J -e mbbtest.err.%J ./subp.sh

the -n 2 is number of processors for teh MPIRUN, it has to be matched with the number of processors (-np) in the subp.sh. If you are using mri/iob queue, the number could be set as 4.

Documentation

Online tutorial available at BEST website.

Commands that are available from the command                                  
   line or from a MrBayes block include:                                         
                                                                                 
   About           -- Describes the program
   Acknowledgments -- Shows program acknowledgments
   Charset         -- Assigns a group of sites to a set
   Charstat        -- Shows status of characters
   Citations       -- Appropriate citation of program
   Comparetree     -- Compares the trees from two tree files
   Constraint      -- Defines a constraint on tree topology
   Ctype           -- Assigns ordering for the characters
   Databreaks      -- Defines nucleotide pairs (doublets) for stem models
   Delete          -- Deletes taxa from the analysis
   Deroot          -- Deroots user tree
   Disclaimer      -- Describes program disclaimer
   Exclude         -- Excludes sites from the analysis
   Execute         -- Executes a file
   Help            -- Provides detailed description of commands
   Include         -- Includes sites
   Link            -- Links parameters across character partitions
   Log             -- Logs screen output to a file
   Lset            -- Sets the parameters of the likelihood model
   Manual          -- Prints a command reference to a text file
   Mcmc            -- Starts Markov chain Monte Carlo analysis
   Mcmcp           -- Sets the parameters of a chain (without starting analysis)
   Outgroup        -- Changes outgroup taxon
   Pairs           -- Defines nucleotide pairs (doublets) for stem models
   Partition       -- Assigns a character partition
   Plot            -- Plots parameters from MCMC analysis
   Prset           -- Sets the priors for the parameters
   Props           -- Set proposal probabilities
   Quit            -- Quits the program
   Report          -- Controls how model parameters are reported
   Restore         -- Restores taxa
   Root            -- Roots user tree
   Set             -- Sets run conditions and defines active data partition
   Showmatrix      -- Shows current character matrix
   Showmodel       -- Shows model settings
   Showtree        -- Shows user tree
   Sump            -- Summarizes parameters from MCMC analysis
   Sumt            -- Summarizes trees from MCMC analysis
   Taxastat        -- Shows status of taxa
   Taxset          -- Assigns a group of taxa to a set
   Unlink          -- Unlinks parameters across character partitions
   Usertree        -- Defines a single user tree
   Version         -- Shows program version
                                                                                 
   Commands that should be in a NEXUS file (data                                 
   block or trees block) include:                                                
                                                                                 
   Begin           -- Denotes beginning of block in file
   Dimensions      -- Defines size of character matrix
   End             -- Denotes end of a block in file
   Endblock        -- Alternative way of denoting end of a block
   Format          -- Defines character format in data block
   Matrix          -- Defines matrix of characters in data block
   Translate       -- Defines alternative names for taxa
   Tree            -- Defines a tree from MCMC analysis
                                                                                 
   Note that this program supports the use of the shortest unambiguous           
   spelling of the above commands (e.g., "exe" instead of "execute"). 

Installation

Source downloaded from BEST website.

System

64-bit Linux