Bismark-Teaching: Difference between revisions

From Research Computing Center Wiki
Jump to navigation Jump to search
(Created page with " Category:TeachingCategory:SoftwareCategory:Bioinformatics === Category === Bioinformatics === Program On === Teaching === Version === 2.2.26 ==...")
 
No edit summary
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
[[Category:Teaching]][[Category:Software]][[Category:Bioinformatics]]
[[Category:Teaching]][[Category:Software]][[Category:Bioinformatics]]
=== Category ===
=== Category ===
Bioinformatics
Bioinformatics


=== Program On ===
=== Program On ===
Teaching
Teaching


=== Version ===
=== Version ===
2.2.26
0.22.1
   
   
=== Author / Distributor ===
=== Author / Distributor ===
Felix Krueger, Bioinformatics Group at the [http://www.bioinformatics.babraham.ac.uk/projects/download.html#bismark Babraham Institute]
[http://blast.ncbi.nlm.nih.gov/ BLAST]
   
   
=== Description ===
=== Description ===
"Basic Local Alignment Search Tool, or BLAST, is an algorithm  for comparing primary biological sequence information, such as the amino-acid  sequences of different proteins or the nucleotides of DNA sequences."
Bismark is a tool to map bisulfite converted sequence reads and determine cytosine methylation states. For more information, please see [http://www.bioinformatics.babraham.ac.uk/projects/download.html#bismark Babraham Institute]
More details are at [http://blast.ncbi.nlm.nih.gov/ BLAST]


=== Running Program ===
=== Running Program ===


The last version of this application is at /usr/local/apps/eb/BLAST/2.2.26-Linux_x86_64
*Version 0.22.1, installed at /usr/local/apps/eb/Bismark/0.22.1-foss-2016b


To use this version, please load the module with
To use this version of Bismark, please first load the module with
<pre class="gscript">
<pre class="gscript">
ml BLAST/2.2.26-Linux_x86_64
module load Bismark/0.22.1-foss-2016b
</pre>  
</pre>  


Line 46: Line 28:
<div class="gscript2">
<div class="gscript2">
<nowiki>#</nowiki>!/bin/bash<br>
<nowiki>#</nowiki>!/bin/bash<br>
<nowiki>#</nowiki>SBATCH --job-name=j_BLAST<br>  
<nowiki>#</nowiki>SBATCH --job-name=jobName<br>  
<nowiki>#</nowiki>SBATCH --partition=batch<br>         
<nowiki>#</nowiki>SBATCH --partition=batch<br>         
<nowiki>#</nowiki>SBATCH --mail-type=ALL<br>  
<nowiki>#</nowiki>SBATCH --mail-type=ALL<br>  
Line 53: Line 35:
<nowiki>#</nowiki>SBATCH --mem=<u>10gb</u><br>     
<nowiki>#</nowiki>SBATCH --mem=<u>10gb</u><br>     
<nowiki>#</nowiki>SBATCH --time=<u>08:00:00</u><br>   
<nowiki>#</nowiki>SBATCH --time=<u>08:00:00</u><br>   
<nowiki>#</nowiki>SBATCH --output=BLAST.%j.out<br>
<nowiki>#</nowiki>SBATCH --output=Bismark.%j.out<br>
<nowiki>#</nowiki>SBATCH --error=BLAST.%j.err<br>
<nowiki>#</nowiki>SBATCH --error=Bismark.%j.err<br>
   
   
cd $SLURM_SUBMIT_DIR<br>
cd $SLURM_SUBMIT_DIR<br>
ml BLAST/2.2.26-Linux_x86_64<br>     
module load Bismark/0.22.1-foss-2016b<br>     
blastall <u>[options]</u><br>   
bismark <u>[options]</u><br>   
</div>
</div>
In the real submission script, at least all the above underlined values need to be reviewed or to be replaced by the proper values.   
In the real submission script, at least all the above underlined values need to be reviewed or to be replaced by the proper values.   


Please refer to [[Running_Jobs_on_the_teaching_cluster]], [[Running_Jobs_on_the_teaching_cluster#Running_an_X-windows_application | Run X window Jobs]] and [[Running_Jobs_on_the_teaching_cluster#How_to_open_an_interactive_session | Run interactive Jobs]] for more details of running jobs at Teaching cluster.
Please refer to [[Running_Jobs_on_the_teaching_cluster]], [[Running_Jobs_on_the_teaching_cluster#Running_an_X-windows_application | Run X window Jobs]] and [[Running_Jobs_on_the_teaching_cluster#How_to_open_an_interactive_session | Run interactive Jobs]] for more details of running jobs at Teaching cluster.


Here is an example of job submission command:
Here is an example of job submission command:
Line 73: Line 55:
   
   
<pre  class="gcommand">
<pre  class="gcommand">
ml BLAST/2.2.26-Linux_x86_64
module load Bismark/0.22.1-foss-2016b
blastall --help
bismark
 
Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.4])
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/local/apps/eb/SAMtools/1.9-foss-2016b/bin/samtools'
Genome folder was not specified!
 
DESCRIPTION
 
The following is a brief description of command line options and arguments to control the Bismark
bisulfite mapper and methylation caller. Bismark takes in FastA or FastQ files and aligns the
reads to a specified bisulfite genome. Sequence reads are transformed into a bisulfite converted forward strand
version (C->T conversion) or into a bisulfite treated reverse strand (G->A conversion of the forward strand).
Each of these reads are then aligned to bisulfite treated forward strand index of a reference genome
(C->T converted) and a bisulfite treated reverse strand index of the genome (G->A conversion of the
forward strand, by doing this alignments will produce the same positions). These 4 instances of Bowtie 2 or HISAT2
are run in parallel. The sequence file(s) are then read in again sequence by sequence to pull out the original
sequence from the genome and determine if there were any protected C's present or not.
 
The final output of Bismark is in BAM/SAM format by default, described in more detail below.
 
 
USAGE: bismark [options] <genome_folder> {-1 <mates1> -2 <mates2> | <singles>}
 
 
ARGUMENTS:
 
<genome_folder>          The path to the folder containing the unmodified reference genome
                        as well as the subfolders created by the Bismark_Genome_Preparation
                        script (/Bisulfite_Genome/CT_conversion/ and /Bisulfite_Genome/GA_conversion/).
                        Bismark expects one or more fastA files in this folder (file extension: .fa, .fa.gz
                        or .fasta or .fasta.gz). The path can be relative or absolute. The path may also be set
                        as '--genome_folder /path/to/genome/folder/'.
 
-1 <mates1>              Comma-separated list of files containing the #1 mates (filename usually includes
                        "_1"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
                        correspond file-for-file and read-for-read with those specified in <mates2>.
                        Reads may be a mix of different lengths. Bismark will produce one mapping result
                        and one report file per paired-end input file pair.
 
-2 <mates2>              Comma-separated list of files containing the #2 mates (filename usually includes
                        "_2"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
                        correspond file-for-file and read-for-read with those specified in <mates1>.
                        Reads may be a mix of different lengths.
 
<singles>                A comma- or space-separated list of files containing the reads to be aligned (e.g.
                        lane1.fq,lane2.fq lane3.fq). Reads may be a mix of different lengths. Bismark will
                        produce one mapping result and one report file per input file. Please note that
                        one should supply a list of files in conjunction with --basename as the output files
                        will constantly overwrite each other...
 
 
 
OPTIONS:
 
 
Input:
 
--se/--single_end <list> Sets single-end mapping mode explicitly giving a list of file names as <list>.
                        The filenames may be provided as a comma [,] or colon [:] separated list.
 
-q/--fastq              The query input files (specified as <mate1>,<mate2> or <singles> are FASTQ
                        files (usually having extension .fg or .fastq). This is the default. See also
                        --solexa-quals.
 
-f/--fasta              The query input files (specified as <mate1>,<mate2> or <singles> are FASTA
                        files (usually having extensions .fa, .mfa, .fna or similar). All quality values
                        are assumed to be 40 on the Phred scale. FASTA files are expected to contain both
                        the read name and the sequence on a single line (and not spread over several lines).
 
-s/--skip <int>          Skip (i.e. do not align) the first <int> reads or read pairs from the input.
 
-u/--upto <int>          Only aligns the first <int> reads or read pairs from the input. Default: no limit.
 
--phred33-quals          FASTQ qualities are ASCII chars equal to the Phred quality plus 33. Default: ON.
 
--phred64-quals          FASTQ qualities are ASCII chars equal to the Phred quality plus 64. Default: off.
 
--path_to_bowtie2        The full path </../../> to the Bowtie 2 installation on your system. If not
                        specified it is assumed that Bowtie 2 is in the PATH.
 
--path_to_hisat2        The full path </../../> to the HISAT2 installation on your system. If not
                        specified it is assumed that HISAT2 is in the PATH.
 
Alignment:
 
 
-N <int>                Sets the number of mismatches to allowed in a seed alignment during multiseed alignment.
                        Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower)
                        but increases sensitivity. Default: 0. This option is only available for Bowtie 2 (for
                        Bowtie 1 see -n).
 
-L <int>                Sets the length of the seed substrings to align during multiseed alignment. Smaller values
                        make alignment slower but more senstive. Default: the --sensitive preset of Bowtie 2 is
                        used by default, which sets -L to 20. maximum of L can be set to 32. The length of the seed
                        would effect the alignment speed dramatically while the larger L, the faster the aligment.
                        This option is only available for Bowtie 2 (for Bowtie 1 see -l).
 
--ignore-quals          When calculating a mismatch penalty, always consider the quality value at the mismatched
                        position to be the highest possible, regardless of the actual value. I.e. input is treated
                        as though all quality values are high. This is also the default behavior when the input
                        doesn't specify quality values (e.g. in -f mode). This option is invariable and on by default.
 
-I/--minins <int>        The minimum insert size for valid paired-end alignments. E.g. if -I 60 is specified and
                        a paired-end alignment consists of two 20-bp alignments in the appropriate orientation
                        with a 20-bp gap between them, that alignment is considered valid (as long as -X is also
                        satisfied). A 19-bp gap would not be valid in that case. Default: 0.
 
-X/--maxins <int>        The maximum insert size for valid paired-end alignments. E.g. if -X 100 is specified and
                        a paired-end alignment consists of two 20-bp alignments in the proper orientation with a
                        60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied).
                        A 61-bp gap would not be valid in that case. Default: 500.
 
--parallel <int>        (May also be --multicore <int>) Sets the number of parallel instances of Bismark to be run concurrently.
                        This forks the Bismark alignment step very early on so that each individual Spawn of Bismark processes
                        only every n-th sequence (n being set by --parallel). Once all processes have completed,
                        the individual BAM files, mapping reports, unmapped or ambiguous FastQ files are merged
                        into single files in very much the same way as they would have been generated running Bismark
                        conventionally with only a single instance.
 
                        If system resources are plentiful this is a viable option to speed up the alignment process
                        (we observed a near linear speed increase for up to --parallel 8 tested). However, please note
                        that a typical Bismark run will use several cores already (Bismark itself, 2 or 4 threads of
                        Bowtie2/HISAT2, Samtools, gzip etc...) and ~10-16GB of memory depending on the choice of aligner
                        and genome. WARNING: Bismark Parallel (BP?) is resource hungry! Each value of --parallel specified
                        will effectively lead to a linear increase in compute and memory requirements, so --parallel 4 for
                        e.g. the GRCm38 mouse genome will probably use ~20 cores and eat ~40GB or RAM, but at the same time
                        reduce the alignment time to ~25-30%. You have been warned.
 
--local                  In this mode, it is not required that the entire read aligns from one end to the other. Rather, some
                        characters may be omitted (“soft-clipped”) from the ends in order to achieve the greatest possible
                        alignment score. For Bowtie 2, the match bonus --ma (default: 2) is used in this mode, and the best possible
                        alignment score is equal to the match bonus (--ma) times the length of the read. This is mutually exclusive with
                        end-to-end alignments. For HISAT2, it is currently not exactly known how the best alignment is calculated.
                        DEFAULT: OFF.
 
 
Output:
 
--non_directional        The sequencing library was constructed in a non strand-specific manner, alignments to all four
                        bisulfite strands will be reported. Default: OFF.
 
                        (The current Illumina protocol for BS-Seq is directional, in which case the strands complementary
                        to the original strands are merely theoretical and should not exist in reality. Specifying directional
                        alignments (which is the default) will only run 2 alignment threads to the original top (OT)
                        or bottom (OB) strands in parallel and report these alignments. This is the recommended option
                        for sprand-specific libraries).
 
--pbat                  This options may be used for PBAT-Seq libraries (Post-Bisulfite Adapter Tagging; Kobayashi et al.,
                        PLoS Genetics, 2012). This is essentially the exact opposite of alignments in 'directional' mode,
                        as it will only launch two alignment threads to the CTOT and CTOB strands instead of the normal OT
                        and OB ones. Use this option only if you are certain that your libraries were constructed following
                        a PBAT protocol (if you don't know what PBAT-Seq is you should not specify this option). The option
                        --pbat works only for FastQ files (in both Bowtie and Bowtie 2 mode) and using uncompressed
                        temporary files only).
 
--sam-no-hd              Suppress SAM header lines (starting with @). This might be useful when very large input files are
                        split up into several smaller files to run concurrently and the output files are to be merged.
 
--rg_tag                Write out a Read Group tag to the resulting SAM/BAM file. This will write the following line to the
                        SAM header: @RG PL: ILLUMINA ID:SAMPLE SM:SAMPLE ; to set ID and SM see --rg_id and --rg_sample.
                        In addition each read receives an RG:Z:RG-ID tag. Default: OFF.
 
--rg_id <string>        Sets the ID field in the @RG header line. The default is 'SAMPLE'.
 
--rg_sample <string>    Sets the SM field in the @RG header line; can't be set without setting --rg_id as well. The default is
                        'SAMPLE'.
 
-un/--unmapped          Write all reads that could not be aligned to a file in the output directory. Written reads will
                        appear as they did in the input, without any translation of quality values that may have
                        taken place within Bowtie or Bismark. Paired-end reads will be written to two parallel files with _1
                        and _2 inserted in their filenames, i.e. _unmapped_reads_1.txt and unmapped_reads_2.txt. Reads
                        with more than one valid alignment with the same number of lowest mismatches (ambiguous mapping)
                        are also written to _unmapped_reads.txt unless the option --ambiguous is specified as well.
 
--ambiguous              Write all reads which produce more than one valid alignment with the same number of lowest
                        mismatches or other reads that fail to align uniquely to a file in the output directory.
                        Written reads will appear as. they did in the input, without any of the translation of quality
                        values that may have taken place within Bowtie or Bismark. Paired-end reads will be written to two
                        parallel files with _1 and _2 inserted in their filenames, i.e. _ambiguous_reads_1.txt and
                        _ambiguous_reads_2.txt. These reads are not written to the file specified with --un.
 
-o/--output_dir <dir>    Write all output files into this directory. By default the output files will be written into
                        the same folder as the input file(s). If the specified folder does not exist, Bismark will attempt
                        to create it first. The path to the output folder can be either relative or absolute.
 
--temp_dir <dir>        Write temporary files to this directory instead of into the same directory as the input files. If
                        the specified folder does not exist, Bismark will attempt to create it first. The path to the
                        temporary folder can be either relative or absolute.
 
--non_bs_mm              Optionally outputs an extra column specifying the number of non-bisulfite mismatches a read during the
                        alignment step. This option is only available for SAM format. In Bowtie 2 context, this value is
                        just the number of actual non-bisulfite mismatches and ignores potential insertions or deletions.
                        The format for single-end reads and read 1 of paired-end reads is 'XA:Z:number of mismatches'
                        and 'XB:Z:number of mismatches' for read 2 of paired-end reads.
 
--gzip                  Temporary bisulfite conversion files will be written out in a GZIP compressed form to save disk
                        space. This option is available for most alignment modes but is not available for paired-end FastA
                        files. This option might be somewhat slower than writing out uncompressed files, but this awaits
                        further testing.
 
--sam                    The output will be written out in SAM format instead of the default BAM format. Bismark will
                        attempt to use the path to Samtools that was specified with '--samtools_path', or, if it hasn't
                        been specified, attempt to find Samtools in the PATH. If no installation of Samtools can be found,
                        the SAM output will be compressed with GZIP instead (yielding a .sam.gz output file).
 
--cram                  Writes the output to a CRAM file instead of BAM. This requires the use of Samtools 1.2 or higher.
 
--cram_ref <ref_file>    CRAM output requires you to specify a reference genome as a single FastA file. If this single-FastA
                        reference file is not supplied explicitly it will be regenerated from the genome .fa sequence(s)
                        used for the Bismark run and written to a file called 'Bismark_genome_CRAM_reference.mfa' into the
                        oputput directory.
 
--samtools_path          The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified
                        explicitly if Samtools is in the PATH already.
 
--prefix <prefix>        Prefixes <prefix> to the output filenames. Trailing dots will be replaced by a single one. For
                        example, '--prefix test' with 'file.fq' would result in the output file 'test.file.fq_bismark.sam' etc.
 
-B/--basename <basename> Write all output to files starting with this base file name. For example, '--basename foo'
                        would result in the files 'foo.bam' and 'foo_SE_report.txt' (or its paired-end equivalent). Takes
                        precedence over --prefix. Be advised that you should not use this option in conjunction with supplying
                        lists of files to be processed consecutively, as all output files will constantly overwrite each other.
 
--old_flag              Only in paired-end SAM mode, uses the FLAG values used by Bismark v0.8.2 and before. In addition,
                        this options appends /1 and /2 to the read IDs for reads 1 and 2 relative to the input file. Since
                        both the appended read IDs and custom FLAG values may cause problems with some downstream tools
                        such as Picard, new defaults were implemented as of version 0.8.3.
 
 
                                            default                        old_flag
                                      ===================              ===================
                                      Read 1      Read 2              Read 1      Read 2
 
                              OT:        99          147                  67          131
 
                              OB:        83          163                115          179
 
                              CTOT:      147          99                  67          131
 
                              CTOB:      163          83                115          179
 
--ambig_bam              For reads that have multiple alignments a random alignment is written out to a special file ending in
                        '.ambiguous.bam'. The alignments are in Bowtie2 format and do not any contain Bismark specific
                        entries such as the methylation call etc. These ambiguous BAM files are intended to be used as
                        coverage estimators for variant callers.
 
--nucleotide_coverage    Calculates the mono- and di-nucleotide sequence composition of covered positions in the analysed BAM
                        file and compares it to the genomic average composition once alignments are complete by calling 'bam2nuc'.
                        Since this calculation may take a while, bam2nuc attempts to write the genomic sequence composition
                        into a file called 'genomic_nucleotide_frequencies.txt' indside the reference genome folder so it can
                        be re-used the next time round instead of calculating it once again. If a file 'nucleotide_stats.txt' is
                        found with the Bismark reports it will be automatically detected and used for the Bismark HTML report.
                        This option works only for BAM or CRAM files.
--icpc                  This option will truncate read IDs at the first space or tab it encounters, which are sometimes used to add
                        comments to a FastQ entry (instead of replacing them with underscores (_) as is the default behaviour). The
                        opion is deliberately somewhat cryptic ("I couldn't possibly comment"), as it only becomes relevant when R1 and R2
                        of read pairs are mapped separately in single-end mode, and then re-paired afterwards (the SAM format dictates
                        that R1 and R2 have the same read ID). Paired-end mapping already creates BAM files with identical read IDs.
                        For more information please see here: https://github.com/FelixKrueger/Bismark/issues/236. Default: OFF.
 
 
OTHER:
 
-h/--help               Displays this help file.
 
-v/--version            Displays version information.
 
 
 
 
BOWTIE 2 SPECIFIC OPTIONS:
 
--bowtie2                Default: ON. Uses Bowtie 2 as default aligner. Bismark limits Bowtie 2 to only perform end-to-end
                        alignments, i.e. searches for alignments involving all read characters (also called
                        untrimmed or unclipped alignments). Bismark assumes that raw sequence data is adapter
                        and/or quality trimmed where appropriate. Both small (.bt2) and large (.bt2l) Bowtie 2
                        indexes are supported. To use HISAT2 instead of Bowtie 2 please see option --hisat2.
--no_dovetail            It is possible, though unusual, for the mates to "dovetail", with the mates seemingly extending
                        "past" each other as in this example:
 
                        Mate 1:                GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
                        Mate 2:            TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
                        Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
 
                        By default, dovetailing is considered inconsistent with concordant alignment, but by default
                        Bismark calls Bowtie 2 with --dovetail, causing it to consider dovetailing alignments as
                        concordant. This becomes relevant whenever reads are clipped from their 5' end prior to mapping,
                        e.g. because of quality or bias issues.
 
                        Specify --no_dovetail to turn off this behaviour for paired-end libraries. Default: OFF.
 
 
HISAT2 SPECIFIC OPTIONS:
 
 
--hisat2                Uses HISAT2 instead of Bowtie 2. Bismark uses HISAT2 in end-to-end mode by default,
                        i.e. searches for alignments involving all read characters (also called untrimmed or unclipped alignments)
                        using the option '--no-softclipping'. Bismark assumes that raw sequence data is adapter and/or quality
                        trimmed where appropriate. From v0.22.0 onwards, Bismark also supports the local alignment mode of
                        HISAT2 (please see --local). Both small (.ht2) and large (.ht2l) HISAT2 indexes are supported. Default: OFF.
 
--no-spliced-alignment  Disable spliced alignment. Default: spliced-alignments are performed.
 
--known-splicesite-infile <path>  Provide a list of known splice sites.
 
 
Paired-end options:
 
--no-mixed              This option disables the behavior to try to find alignments for the individual mates if
                        it cannot find a concordant or discordant alignment for a pair. This option is invariably on by default.
 
--no-discordant          Normally, Bowtie 2 or HISAT2 look for discordant alignments if it cannot find any concordant alignments.
                        A discordant alignment is an alignment where both mates align uniquely, but that does not
                        satisfy the paired-end constraints (--fr/--rf/--ff, -I, -X). This option disables that behavior
                        and it is on by default.
 


blastall 2.2.26  arguments:


  -p  Program Name [String]
Bowtie 2 effort options:
  -d  Database [String]
    default = nr
  -i  Query File [File In]
    default = stdin
  -e  Expectation value (E) [Real]
    default = 10.0
  -m  alignment view options:
0 = pairwise,
1 = query-anchored showing identities,
2 = query-anchored no identities,
3 = flat query-anchored, show identities,
4 = flat query-anchored, no identities,
5 = query-anchored no identities and blunt ends,
6 = flat query-anchored, no identities and blunt ends,
7 = XML Blast output,
8 = tabular,
9 tabular with comment lines
10 ASN, text
11 ASN, binary [Integer]
    default = 0
    range from 0 to 11
  -o  BLAST report Output File [File Out]  Optional
    default = stdout
  -F  Filter query sequence (DUST with blastn, SEG with others) [String]
    default = T
  -G  Cost to open a gap (-1 invokes default behavior) [Integer]
    default = -1
  -E  Cost to extend a gap (-1 invokes default behavior) [Integer]
    default = -1
  -X  X dropoff value for gapped alignment (in bits) (zero invokes default behavior)
      blastn 30, megablast 20, tblastx 0, all others 15 [Integer]
    default = 0
  -I  Show GI's in deflines [T/F]
    default = F
  -q  Penalty for a nucleotide mismatch (blastn only) [Integer]
    default = -3
  -r  Reward for a nucleotide match (blastn only) [Integer]
    default = 1
  -v  Number of database sequences to show one-line descriptions for (V) [Integer]
    default = 500
  -b  Number of database sequence to show alignments for (B) [Integer]
    default = 250
  -f  Threshold for extending hits, default if zero
      blastp 11, blastn 0, blastx 12, tblastn 13
      tblastx 13, megablast 0 [Real]
    default = 0
  -g  Perform gapped alignment (not available with tblastx) [T/F]
    default = T
  -Q  Query Genetic code to use [Integer]
    default = 1
  -D  DB Genetic code (for tblast[nx] only) [Integer]
    default = 1
  -a  Number of processors to use [Integer]
    default = 1
  -O  SeqAlign file [File Out]  Optional
  -J  Believe the query defline [T/F]
    default = F
  -M  Matrix [String]
    default = BLOSUM62
  -W  Word size, default if zero (blastn 11, megablast 28, all others 3) [Integer]
    default = 0
  -z  Effective length of the database (use zero for the real size) [Real]
    default = 0
  -K  Number of best hits from a region to keep. Off by default.
If used a value of 100 is recommended.  Very high values of -v or -b is also suggested [Integer]
    default = 0
  -P  0 for multiple hit, 1 for single hit (does not apply to blastn) [Integer]
    default = 0
  -Y  Effective length of the search space (use zero for the real size) [Real]
    default = 0
  -S  Query strands to search against database (for blast[nx], and tblastx)
      3 is both, 1 is top, 2 is bottom [Integer]
    default = 3
  -T  Produce HTML output [T/F]
    default = F
  -l  Restrict search of database to list of GI's [String]  Optional
  -U  Use lower case filtering of FASTA sequence [T/F]  Optional
  -y  X dropoff value for ungapped extensions in bits (0.0 invokes default behavior)
      blastn 20, megablast 10, all others 7 [Real]
    default = 0.0
  -Z  X dropoff value for final gapped alignment in bits (0.0 invokes default behavior)
      blastn/megablast 100, tblastx 0, all others 25 [Integer]
    default = 0
  -R  PSI-TBLASTN checkpoint file [File In]  Optional
  -n  MegaBlast search [T/F]
    default = F
  -L  Location on query sequence [String]  Optional
  -A  Multiple Hits window size, default if zero (blastn/megablast 0, all others 40 [Integer]
    default = 0
  -w  Frame shift penalty (OOF algorithm for blastx) [Integer]
    default = 0
  -t  Length of the largest intron allowed in a translated nucleotide sequence when linking multiple distinct alignments. (0 invokes default behavior; a negative value disables linking.) [Integer]
    default = 0
  -B  Number of concatenated queries, for blastn and tblastn [Integer]  Optional
    default = 0
  -V  Force use of the legacy BLAST engine [T/F]  Optional
    default = F
  -C  Use composition-based score adjustments for blastp or tblastn:
      As first character:
      D or d: default (equivalent to T)
      0 or F or f: no composition-based statistics
      2 or T or t: Composition-based score adjustments as in Bioinformatics 21:902-911,
      1: Composition-based statistics as in NAR 29:2994-3005, 2001
          2005, conditioned on sequence properties
      3: Composition-based score adjustment as in Bioinformatics 21:902-911,
          2005, unconditionally
      For programs other than tblastn, must either be absent or be D, F or 0.
          As second character, if first character is equivalent to 1, 2, or 3:
      U or u: unified p-value combining alignment p-value and compositional p-value in round 1 only
[String]
    default = D
  -s  Compute locally optimal Smith-Waterman alignments (This option is only
      available for gapped tblastn.) [T/F]
    default = F


-D <int>                Up to <int> consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using
                        the alignments found so far. A seed extension "fails" if it does not yield a new best or a
                        new second-best alignment. Default: 15.


-R <int>                <int> is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds.
                        When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of
                        mismatches allowed) at different offsets and searches for more alignments. A read is considered
                        to have repetitive seeds if the total number of seed hits divided by the number of seeds
                        that aligned at least once is greater than 300. Default: 2.
Bowtie 2/ HISAT2 parallelization options:
-p NTHREADS              Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores
                        and synchronize when parsing reads and outputting alignments. Searching for alignments is highly
                        parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint.
                        E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint
                        by a few hundred megabytes. This option is only available if bowtie is linked with the pthreads
                        library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time). In addition, this option will
                        automatically use the option '--reorder', which guarantees that output SAM records are printed in
                        an order corresponding to the order of the reads in the original input file, even when -p is set
                        greater than 1 (Bismark requires the Bowtie 2 output to be this way). Specifying --reorder and
                        setting -p greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory then
                        if --reorder were not specified. Has no effect if -p is set to 1, since output order will naturally
                        correspond to input order in that case.
Scoring options:
--score_min <func>      Sets a function governing the minimum alignment score needed for an alignment to be considered
                        "valid" (i.e. good enough to report). This is a function of read length.
                        In end-to-end mode (default), and --local mode for HISAT2 only, --score_min is set as a linear function
                        and is set as <L,value,value>.
                        For instance, specifying L,0,-0.2 sets the minimum-score function f to f(x) = 0 + (-0.2) * x, where x
                        is the read length. The default for end-to-end (global) alignments is: L,0,-0.2.
                       
                        In --local mode for Bowtie 2, the function is logarithmic and is set as <G,value,value>. For instance, specifying
                        G,20,8 sets the minimum-score function f to f(x) = 20 + 8 * ln(x), where x is the read length.
                        The default is for local alignments in Bowtie 2 mode is: G,20,8.
                        See also: setting function options at http://bowtie-bio.sourceforge.net/bowtie2.
--rdg <int1>,<int2>      Sets the read gap open (<int1>) and extend (<int2>) penalties. A read gap of length N gets a penalty
                        of <int1> + N * <int2>. Default: 5, 3.
--rfg <int1>,<int2>      Sets the reference gap open (<int1>) and extend (<int2>) penalties. A reference gap of length N gets
                        a penalty of <int1> + N * <int2>. Default: 5, 3.
Bismark BAM/SAM OUTPUT (default):
(1) QNAME  (seq-ID)
(2) FLAG  (this flag tries to take the strand a bisulfite read originated from into account (this is different from ordinary DNA alignment flags!))
(3) RNAME  (chromosome)
(4) POS    (start position)
(5) MAPQ  (always 255 for use with Bowtie)
(6) CIGAR
(7) RNEXT
(8) PNEXT
(9) TLEN
(10) SEQ
(11) QUAL  (Phred33 scale)
(12) NM-tag (edit distance to the reference)
(13) MD-tag (base-by-base mismatches to the reference (handles indels)
(14) XM-tag (methylation call string)
(15) XR-tag (read conversion state for the alignment)
(16) XG-tag (genome conversion state for the alignment)
(17) XA/XB-tag (non-bisulfite mismatches) (optional!)
Each read of paired-end alignments is written out in a separate line in the above format.
Last modified on 21 April 2019
</pre>
</pre>
[[#top|Back to Top]]
[[#top|Back to Top]]
Line 200: Line 458:
=== Installation ===
=== Installation ===
   
   
Source code is obtained from [http://blast.ncbi.nlm.nih.gov/ BLAST]
Binary code downloaded from [http://www.bioinformatics.babraham.ac.uk/projects/download.html#bismark Bismark]
 
=== System ===
=== System ===
64-bit Linux
64-bit Linux

Latest revision as of 10:27, 25 November 2019

Category

Bioinformatics

Program On

Teaching

Version

0.22.1

Author / Distributor

Felix Krueger, Bioinformatics Group at the Babraham Institute

Description

Bismark is a tool to map bisulfite converted sequence reads and determine cytosine methylation states. For more information, please see Babraham Institute

Running Program

  • Version 0.22.1, installed at /usr/local/apps/eb/Bismark/0.22.1-foss-2016b

To use this version of Bismark, please first load the module with

module load Bismark/0.22.1-foss-2016b

Here is an example of a shell script, sub.sh, to run on the batch queue:

#!/bin/bash
#SBATCH --job-name=jobName
#SBATCH --partition=batch
#SBATCH --mail-type=ALL
#SBATCH --mail-user=username@uga.edu
#SBATCH --ntasks=1
#SBATCH --mem=10gb
#SBATCH --time=08:00:00
#SBATCH --output=Bismark.%j.out
#SBATCH --error=Bismark.%j.err

cd $SLURM_SUBMIT_DIR
module load Bismark/0.22.1-foss-2016b
bismark [options]

In the real submission script, at least all the above underlined values need to be reviewed or to be replaced by the proper values.

Please refer to Running_Jobs_on_the_teaching_cluster, Run X window Jobs and Run interactive Jobs for more details of running jobs at Teaching cluster.

Here is an example of job submission command:

sbatch ./sub.sh 

Documentation

module load Bismark/0.22.1-foss-2016b
bismark

Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.4])
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/local/apps/eb/SAMtools/1.9-foss-2016b/bin/samtools'
Genome folder was not specified!

DESCRIPTION

The following is a brief description of command line options and arguments to control the Bismark
bisulfite mapper and methylation caller. Bismark takes in FastA or FastQ files and aligns the
reads to a specified bisulfite genome. Sequence reads are transformed into a bisulfite converted forward strand
version (C->T conversion) or into a bisulfite treated reverse strand (G->A conversion of the forward strand).
Each of these reads are then aligned to bisulfite treated forward strand index of a reference genome
(C->T converted) and a bisulfite treated reverse strand index of the genome (G->A conversion of the
forward strand, by doing this alignments will produce the same positions). These 4 instances of Bowtie 2 or HISAT2
are run in parallel. The sequence file(s) are then read in again sequence by sequence to pull out the original
sequence from the genome and determine if there were any protected C's present or not.

The final output of Bismark is in BAM/SAM format by default, described in more detail below.


USAGE: bismark [options] <genome_folder> {-1 <mates1> -2 <mates2> | <singles>}


ARGUMENTS:

<genome_folder>          The path to the folder containing the unmodified reference genome
                         as well as the subfolders created by the Bismark_Genome_Preparation
                         script (/Bisulfite_Genome/CT_conversion/ and /Bisulfite_Genome/GA_conversion/).
                         Bismark expects one or more fastA files in this folder (file extension: .fa, .fa.gz
                         or .fasta or .fasta.gz). The path can be relative or absolute. The path may also be set
                         as '--genome_folder /path/to/genome/folder/'.

-1 <mates1>              Comma-separated list of files containing the #1 mates (filename usually includes
                         "_1"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
                         correspond file-for-file and read-for-read with those specified in <mates2>.
                         Reads may be a mix of different lengths. Bismark will produce one mapping result
                         and one report file per paired-end input file pair.

-2 <mates2>              Comma-separated list of files containing the #2 mates (filename usually includes
                         "_2"), e.g. flyA_1.fq,flyB_1.fq). Sequences specified with this option must
                         correspond file-for-file and read-for-read with those specified in <mates1>.
                         Reads may be a mix of different lengths.

<singles>                A comma- or space-separated list of files containing the reads to be aligned (e.g.
                         lane1.fq,lane2.fq lane3.fq). Reads may be a mix of different lengths. Bismark will
                         produce one mapping result and one report file per input file. Please note that
                         one should supply a list of files in conjunction with --basename as the output files
                         will constantly overwrite each other...



OPTIONS:


Input:

--se/--single_end <list> Sets single-end mapping mode explicitly giving a list of file names as <list>.
                         The filenames may be provided as a comma [,] or colon [:] separated list.

-q/--fastq               The query input files (specified as <mate1>,<mate2> or <singles> are FASTQ
                         files (usually having extension .fg or .fastq). This is the default. See also
                         --solexa-quals.

-f/--fasta               The query input files (specified as <mate1>,<mate2> or <singles> are FASTA
                         files (usually having extensions .fa, .mfa, .fna or similar). All quality values
                         are assumed to be 40 on the Phred scale. FASTA files are expected to contain both
                         the read name and the sequence on a single line (and not spread over several lines).

-s/--skip <int>          Skip (i.e. do not align) the first <int> reads or read pairs from the input.

-u/--upto <int>          Only aligns the first <int> reads or read pairs from the input. Default: no limit.

--phred33-quals          FASTQ qualities are ASCII chars equal to the Phred quality plus 33. Default: ON.

--phred64-quals          FASTQ qualities are ASCII chars equal to the Phred quality plus 64. Default: off.

--path_to_bowtie2        The full path </../../> to the Bowtie 2 installation on your system. If not
                         specified it is assumed that Bowtie 2 is in the PATH.

--path_to_hisat2         The full path </../../> to the HISAT2 installation on your system. If not
                         specified it is assumed that HISAT2 is in the PATH.

Alignment:


-N <int>                 Sets the number of mismatches to allowed in a seed alignment during multiseed alignment.
                         Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower)
                         but increases sensitivity. Default: 0. This option is only available for Bowtie 2 (for
                         Bowtie 1 see -n).

-L <int>                 Sets the length of the seed substrings to align during multiseed alignment. Smaller values
                         make alignment slower but more senstive. Default: the --sensitive preset of Bowtie 2 is
                         used by default, which sets -L to 20. maximum of L can be set to 32. The length of the seed
                         would effect the alignment speed dramatically while the larger L, the faster the aligment.
                         This option is only available for Bowtie 2 (for Bowtie 1 see -l).

--ignore-quals           When calculating a mismatch penalty, always consider the quality value at the mismatched
                         position to be the highest possible, regardless of the actual value. I.e. input is treated
                         as though all quality values are high. This is also the default behavior when the input
                         doesn't specify quality values (e.g. in -f mode). This option is invariable and on by default.

-I/--minins <int>        The minimum insert size for valid paired-end alignments. E.g. if -I 60 is specified and
                         a paired-end alignment consists of two 20-bp alignments in the appropriate orientation
                         with a 20-bp gap between them, that alignment is considered valid (as long as -X is also
                         satisfied). A 19-bp gap would not be valid in that case. Default: 0.

-X/--maxins <int>        The maximum insert size for valid paired-end alignments. E.g. if -X 100 is specified and
                         a paired-end alignment consists of two 20-bp alignments in the proper orientation with a
                         60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied).
                         A 61-bp gap would not be valid in that case. Default: 500.

--parallel <int>         (May also be --multicore <int>) Sets the number of parallel instances of Bismark to be run concurrently.
                         This forks the Bismark alignment step very early on so that each individual Spawn of Bismark processes
                         only every n-th sequence (n being set by --parallel). Once all processes have completed,
                         the individual BAM files, mapping reports, unmapped or ambiguous FastQ files are merged
                         into single files in very much the same way as they would have been generated running Bismark
                         conventionally with only a single instance.

                         If system resources are plentiful this is a viable option to speed up the alignment process
                         (we observed a near linear speed increase for up to --parallel 8 tested). However, please note
                         that a typical Bismark run will use several cores already (Bismark itself, 2 or 4 threads of
                         Bowtie2/HISAT2, Samtools, gzip etc...) and ~10-16GB of memory depending on the choice of aligner
                         and genome. WARNING: Bismark Parallel (BP?) is resource hungry! Each value of --parallel specified
                         will effectively lead to a linear increase in compute and memory requirements, so --parallel 4 for
                         e.g. the GRCm38 mouse genome will probably use ~20 cores and eat ~40GB or RAM, but at the same time
                         reduce the alignment time to ~25-30%. You have been warned.

--local                  In this mode, it is not required that the entire read aligns from one end to the other. Rather, some
                         characters may be omitted (“soft-clipped”) from the ends in order to achieve the greatest possible
                         alignment score. For Bowtie 2, the match bonus --ma (default: 2) is used in this mode, and the best possible
                         alignment score is equal to the match bonus (--ma) times the length of the read. This is mutually exclusive with
                         end-to-end alignments. For HISAT2, it is currently not exactly known how the best alignment is calculated.
                         DEFAULT: OFF.


Output:

--non_directional        The sequencing library was constructed in a non strand-specific manner, alignments to all four
                         bisulfite strands will be reported. Default: OFF.

                         (The current Illumina protocol for BS-Seq is directional, in which case the strands complementary
                         to the original strands are merely theoretical and should not exist in reality. Specifying directional
                         alignments (which is the default) will only run 2 alignment threads to the original top (OT)
                         or bottom (OB) strands in parallel and report these alignments. This is the recommended option
                         for sprand-specific libraries).

--pbat                   This options may be used for PBAT-Seq libraries (Post-Bisulfite Adapter Tagging; Kobayashi et al.,
                         PLoS Genetics, 2012). This is essentially the exact opposite of alignments in 'directional' mode,
                         as it will only launch two alignment threads to the CTOT and CTOB strands instead of the normal OT
                         and OB ones. Use this option only if you are certain that your libraries were constructed following
                         a PBAT protocol (if you don't know what PBAT-Seq is you should not specify this option). The option
                         --pbat works only for FastQ files (in both Bowtie and Bowtie 2 mode) and using uncompressed
                         temporary files only).

--sam-no-hd              Suppress SAM header lines (starting with @). This might be useful when very large input files are
                         split up into several smaller files to run concurrently and the output files are to be merged.

--rg_tag                 Write out a Read Group tag to the resulting SAM/BAM file. This will write the following line to the
                         SAM header: @RG PL: ILLUMINA ID:SAMPLE SM:SAMPLE ; to set ID and SM see --rg_id and --rg_sample.
                         In addition each read receives an RG:Z:RG-ID tag. Default: OFF.

--rg_id <string>         Sets the ID field in the @RG header line. The default is 'SAMPLE'.

--rg_sample <string>     Sets the SM field in the @RG header line; can't be set without setting --rg_id as well. The default is
                         'SAMPLE'.

-un/--unmapped           Write all reads that could not be aligned to a file in the output directory. Written reads will
                         appear as they did in the input, without any translation of quality values that may have
                         taken place within Bowtie or Bismark. Paired-end reads will be written to two parallel files with _1
                         and _2 inserted in their filenames, i.e. _unmapped_reads_1.txt and unmapped_reads_2.txt. Reads
                         with more than one valid alignment with the same number of lowest mismatches (ambiguous mapping)
                         are also written to _unmapped_reads.txt unless the option --ambiguous is specified as well.

--ambiguous              Write all reads which produce more than one valid alignment with the same number of lowest
                         mismatches or other reads that fail to align uniquely to a file in the output directory.
                         Written reads will appear as. they did in the input, without any of the translation of quality
                         values that may have taken place within Bowtie or Bismark. Paired-end reads will be written to two
                         parallel files with _1 and _2 inserted in their filenames, i.e. _ambiguous_reads_1.txt and
                         _ambiguous_reads_2.txt. These reads are not written to the file specified with --un.

-o/--output_dir <dir>    Write all output files into this directory. By default the output files will be written into
                         the same folder as the input file(s). If the specified folder does not exist, Bismark will attempt
                         to create it first. The path to the output folder can be either relative or absolute.

--temp_dir <dir>         Write temporary files to this directory instead of into the same directory as the input files. If
                         the specified folder does not exist, Bismark will attempt to create it first. The path to the
                         temporary folder can be either relative or absolute.

--non_bs_mm              Optionally outputs an extra column specifying the number of non-bisulfite mismatches a read during the
                         alignment step. This option is only available for SAM format. In Bowtie 2 context, this value is
                         just the number of actual non-bisulfite mismatches and ignores potential insertions or deletions.
                         The format for single-end reads and read 1 of paired-end reads is 'XA:Z:number of mismatches'
                         and 'XB:Z:number of mismatches' for read 2 of paired-end reads.

--gzip                   Temporary bisulfite conversion files will be written out in a GZIP compressed form to save disk
                         space. This option is available for most alignment modes but is not available for paired-end FastA
                         files. This option might be somewhat slower than writing out uncompressed files, but this awaits
                         further testing.

--sam                    The output will be written out in SAM format instead of the default BAM format. Bismark will
                         attempt to use the path to Samtools that was specified with '--samtools_path', or, if it hasn't
                         been specified, attempt to find Samtools in the PATH. If no installation of Samtools can be found,
                         the SAM output will be compressed with GZIP instead (yielding a .sam.gz output file).

--cram                   Writes the output to a CRAM file instead of BAM. This requires the use of Samtools 1.2 or higher.

--cram_ref <ref_file>    CRAM output requires you to specify a reference genome as a single FastA file. If this single-FastA
                         reference file is not supplied explicitly it will be regenerated from the genome .fa sequence(s)
                         used for the Bismark run and written to a file called 'Bismark_genome_CRAM_reference.mfa' into the
                         oputput directory.

--samtools_path          The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified
                         explicitly if Samtools is in the PATH already.

--prefix <prefix>        Prefixes <prefix> to the output filenames. Trailing dots will be replaced by a single one. For
                         example, '--prefix test' with 'file.fq' would result in the output file 'test.file.fq_bismark.sam' etc.

-B/--basename <basename> Write all output to files starting with this base file name. For example, '--basename foo'
                         would result in the files 'foo.bam' and 'foo_SE_report.txt' (or its paired-end equivalent). Takes
                         precedence over --prefix. Be advised that you should not use this option in conjunction with supplying
                         lists of files to be processed consecutively, as all output files will constantly overwrite each other.

--old_flag               Only in paired-end SAM mode, uses the FLAG values used by Bismark v0.8.2 and before. In addition,
                         this options appends /1 and /2 to the read IDs for reads 1 and 2 relative to the input file. Since
                         both the appended read IDs and custom FLAG values may cause problems with some downstream tools
                         such as Picard, new defaults were implemented as of version 0.8.3.


                                             default                         old_flag
                                       ===================              ===================
                                       Read 1       Read 2              Read 1       Read 2

                              OT:         99          147                  67          131

                              OB:         83          163                 115          179

                              CTOT:      147           99                  67          131

                              CTOB:      163           83                 115          179

--ambig_bam              For reads that have multiple alignments a random alignment is written out to a special file ending in
                         '.ambiguous.bam'. The alignments are in Bowtie2 format and do not any contain Bismark specific
                         entries such as the methylation call etc. These ambiguous BAM files are intended to be used as
                         coverage estimators for variant callers.

--nucleotide_coverage    Calculates the mono- and di-nucleotide sequence composition of covered positions in the analysed BAM
                         file and compares it to the genomic average composition once alignments are complete by calling 'bam2nuc'.
                         Since this calculation may take a while, bam2nuc attempts to write the genomic sequence composition
                         into a file called 'genomic_nucleotide_frequencies.txt' indside the reference genome folder so it can
                         be re-used the next time round instead of calculating it once again. If a file 'nucleotide_stats.txt' is
                         found with the Bismark reports it will be automatically detected and used for the Bismark HTML report.
                         This option works only for BAM or CRAM files.
						 
--icpc                   This option will truncate read IDs at the first space or tab it encounters, which are sometimes used to add
                         comments to a FastQ entry (instead of replacing them with underscores (_) as is the default behaviour). The
                         opion is deliberately somewhat cryptic ("I couldn't possibly comment"), as it only becomes relevant when R1 and R2
                         of read pairs are mapped separately in single-end mode, and then re-paired afterwards (the SAM format dictates
                         that R1 and R2 have the same read ID). Paired-end mapping already creates BAM files with identical read IDs.
                         For more information please see here: https://github.com/FelixKrueger/Bismark/issues/236. Default: OFF.


OTHER:

-h/--help                Displays this help file.

-v/--version             Displays version information.




BOWTIE 2 SPECIFIC OPTIONS:

--bowtie2                Default: ON. Uses Bowtie 2 as default aligner. Bismark limits Bowtie 2 to only perform end-to-end
                         alignments, i.e. searches for alignments involving all read characters (also called
                         untrimmed or unclipped alignments). Bismark assumes that raw sequence data is adapter
                         and/or quality trimmed where appropriate. Both small (.bt2) and large (.bt2l) Bowtie 2
                         indexes are supported. To use HISAT2 instead of Bowtie 2 please see option --hisat2.
						 
						 
--no_dovetail            It is possible, though unusual, for the mates to "dovetail", with the mates seemingly extending
                         "past" each other as in this example:

                         Mate 1:                 GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
                         Mate 2:            TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
                         Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

                         By default, dovetailing is considered inconsistent with concordant alignment, but by default
                         Bismark calls Bowtie 2 with --dovetail, causing it to consider dovetailing alignments as
                         concordant. This becomes relevant whenever reads are clipped from their 5' end prior to mapping,
                         e.g. because of quality or bias issues.

                         Specify --no_dovetail to turn off this behaviour for paired-end libraries. Default: OFF.


HISAT2 SPECIFIC OPTIONS:


--hisat2                 Uses HISAT2 instead of Bowtie 2. Bismark uses HISAT2 in end-to-end mode by default,
                         i.e. searches for alignments involving all read characters (also called untrimmed or unclipped alignments)
                         using the option '--no-softclipping'. Bismark assumes that raw sequence data is adapter and/or quality
                         trimmed where appropriate. From v0.22.0 onwards, Bismark also supports the local alignment mode of
                         HISAT2 (please see --local). Both small (.ht2) and large (.ht2l) HISAT2 indexes are supported. Default: OFF. 

--no-spliced-alignment   Disable spliced alignment. Default: spliced-alignments are performed.

--known-splicesite-infile <path>   Provide a list of known splice sites.


Paired-end options:

--no-mixed               This option disables the behavior to try to find alignments for the individual mates if
                         it cannot find a concordant or discordant alignment for a pair. This option is invariably on by default.

--no-discordant          Normally, Bowtie 2 or HISAT2 look for discordant alignments if it cannot find any concordant alignments.
                         A discordant alignment is an alignment where both mates align uniquely, but that does not
                         satisfy the paired-end constraints (--fr/--rf/--ff, -I, -X). This option disables that behavior
                         and it is on by default.



Bowtie 2 effort options:

-D <int>                 Up to <int> consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using
                         the alignments found so far. A seed extension "fails" if it does not yield a new best or a
                         new second-best alignment. Default: 15.

-R <int>                 <int> is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds.
                         When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of
                         mismatches allowed) at different offsets and searches for more alignments. A read is considered
                         to have repetitive seeds if the total number of seed hits divided by the number of seeds
                         that aligned at least once is greater than 300. Default: 2.

Bowtie 2/ HISAT2 parallelization options:


-p NTHREADS              Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores
                         and synchronize when parsing reads and outputting alignments. Searching for alignments is highly
                         parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint.
                         E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint
                         by a few hundred megabytes. This option is only available if bowtie is linked with the pthreads
                         library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time). In addition, this option will
                         automatically use the option '--reorder', which guarantees that output SAM records are printed in
                         an order corresponding to the order of the reads in the original input file, even when -p is set
                         greater than 1 (Bismark requires the Bowtie 2 output to be this way). Specifying --reorder and
                         setting -p greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory then
                         if --reorder were not specified. Has no effect if -p is set to 1, since output order will naturally
                         correspond to input order in that case.

Scoring options:

--score_min <func>       Sets a function governing the minimum alignment score needed for an alignment to be considered
                         "valid" (i.e. good enough to report). This is a function of read length. 

                         In end-to-end mode (default), and --local mode for HISAT2 only, --score_min is set as a linear function
                         and is set as <L,value,value>.
                         For instance, specifying L,0,-0.2 sets the minimum-score function f to f(x) = 0 + (-0.2) * x, where x
                         is the read length. The default for end-to-end (global) alignments is: L,0,-0.2.
                         
                         In --local mode for Bowtie 2, the function is logarithmic and is set as <G,value,value>. For instance, specifying
                         G,20,8 sets the minimum-score function f to f(x) = 20 + 8 * ln(x), where x is the read length.
                         The default is for local alignments in Bowtie 2 mode is: G,20,8.
						 
                         See also: setting function options at http://bowtie-bio.sourceforge.net/bowtie2.

--rdg <int1>,<int2>      Sets the read gap open (<int1>) and extend (<int2>) penalties. A read gap of length N gets a penalty
                         of <int1> + N * <int2>. Default: 5, 3.

--rfg <int1>,<int2>      Sets the reference gap open (<int1>) and extend (<int2>) penalties. A reference gap of length N gets
                         a penalty of <int1> + N * <int2>. Default: 5, 3.



Bismark BAM/SAM OUTPUT (default):

 (1) QNAME  (seq-ID)
 (2) FLAG   (this flag tries to take the strand a bisulfite read originated from into account (this is different from ordinary DNA alignment flags!))
 (3) RNAME  (chromosome)
 (4) POS    (start position)
 (5) MAPQ   (always 255 for use with Bowtie)
 (6) CIGAR
 (7) RNEXT
 (8) PNEXT
 (9) TLEN
(10) SEQ
(11) QUAL   (Phred33 scale)
(12) NM-tag (edit distance to the reference)
(13) MD-tag (base-by-base mismatches to the reference (handles indels)
(14) XM-tag (methylation call string)
(15) XR-tag (read conversion state for the alignment)
(16) XG-tag (genome conversion state for the alignment)
(17) XA/XB-tag (non-bisulfite mismatches) (optional!)

Each read of paired-end alignments is written out in a separate line in the above format.

Last modified on 21 April 2019

Back to Top

Installation

Binary code downloaded from Bismark

System

64-bit Linux