BEST Bayesian: Difference between revisions
(Created page with "Category:ZclusterCategory:SoftwareCategory:Bioinformatics === Category === Bioinformatics === Program On === zcluster === Version === 2.3.1 === Author / ...") |
(No difference)
|
Revision as of 20:38, 7 February 2013
Category
Bioinformatics
Program On
zcluster
Version
2.3.1
Author / Distributor
Description
BLAST (Basic Local Alignment Search Tool), more details at NCBI
Running Program
BEST is a free phylogenetics program to estimate the joint posterior distribution of gene trees and species tree using multilocus molecular data that accounts for deep coalescence but not for other issues such as horizontal transfer or gene duplication.
This code works as a modification of the popular phylogenetics software package
mbbest, /usr/local/BEST/latest/mbbest are always pointed to the latest update version.
Version: /usr/local/BEST/2.3.1/mbbest /usr/local/BEST/2.2/mbbest
Example of interactive program. Please refer to here about running jobs at interactive nodes.
ssh -Y inter2 mbbest ... exit
When running MPI jobs on the rcluster interactive node (inter2), please first create a file host.list. Refer to Running an Interactive Job for details about host.list. The host.file will as:
inter2 inter2 inter2 inter2
Then run the mpirun command with:
ssh -Y inter2 mpirun -np 2 -machinefile host.list mbbest
Where the "2" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.
To quit the program, type q and ENTER
Run the job in the queue, also refer to submit jobs to queues at rcluster, IOB
Below is an example file defines the data. Save this file as e.x. yh.nex
cp /usr/local/mrbayes/primates.nex yh.nex
Content of yh.nex is:
#NEXUS begin data; dimensions ntax=12 nchar=898; format datatype=dna interleave=no gap=-; matrix Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATTTTGC TACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAACATGA .... end;
Define all the parameters in the .par file, e.x. yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.
set autoclose=yes nowarn=yes; execute yh.nex; lset nst=6 rates=gamma; mcmc nruns=1 ngen=10000 samplefreq=10 file=yh.nex1; mcmc file=yh.nex2; mcmc file=yh.nex3;
Below is a script subp.sh to the batch queue, yh.par is the file definced above
#!/bin/bash cd my-working-dir echo $LSB_HOSTS cat /dev/null > mlist.$$ for variable in $LSB_HOSTS; do echo $variable >> mlist.$$ done mpirun -np 2 -machinefile mlist.$$ /usr/local/BEST/latest/mbbest < yh.par > myout rm -f mlist.$$ x
After saved the subp.sh, use following add excute permission to the subp.sh
chmod u+x subp.sh
Then submit all these to the queue as
bsub -n 2 -q rcc-r32-30d -o mbbtest.out.%J -e mbbtest.err.%J ./subp.sh
the -n 2 is number of processors for teh MPIRUN, it has to be matched with the number of processors (-np) in the subp.sh. If you are using mri/iob queue, the number could be set as 4.
Documentation
Online tutorial available at BEST website.
Commands that are available from the command
line or from a MrBayes block include: About -- Describes the program Acknowledgments -- Shows program acknowledgments Charset -- Assigns a group of sites to a set Charstat -- Shows status of characters Citations -- Appropriate citation of program Comparetree -- Compares the trees from two tree files Constraint -- Defines a constraint on tree topology Ctype -- Assigns ordering for the characters Databreaks -- Defines nucleotide pairs (doublets) for stem models Delete -- Deletes taxa from the analysis Deroot -- Deroots user tree Disclaimer -- Describes program disclaimer Exclude -- Excludes sites from the analysis Execute -- Executes a file Help -- Provides detailed description of commands Include -- Includes sites Link -- Links parameters across character partitions Log -- Logs screen output to a file Lset -- Sets the parameters of the likelihood model Manual -- Prints a command reference to a text file Mcmc -- Starts Markov chain Monte Carlo analysis Mcmcp -- Sets the parameters of a chain (without starting analysis) Outgroup -- Changes outgroup taxon Pairs -- Defines nucleotide pairs (doublets) for stem models Partition -- Assigns a character partition Plot -- Plots parameters from MCMC analysis Prset -- Sets the priors for the parameters Props -- Set proposal probabilities Quit -- Quits the program Report -- Controls how model parameters are reported Restore -- Restores taxa Root -- Roots user tree Set -- Sets run conditions and defines active data partition Showmatrix -- Shows current character matrix Showmodel -- Shows model settings Showtree -- Shows user tree Sump -- Summarizes parameters from MCMC analysis Sumt -- Summarizes trees from MCMC analysis Taxastat -- Shows status of taxa Taxset -- Assigns a group of taxa to a set Unlink -- Unlinks parameters across character partitions Usertree -- Defines a single user tree Version -- Shows program version Commands that should be in a NEXUS file (data block or trees block) include: Begin -- Denotes beginning of block in file Dimensions -- Defines size of character matrix End -- Denotes end of a block in file Endblock -- Alternative way of denoting end of a block Format -- Defines character format in data block Matrix -- Defines matrix of characters in data block Translate -- Defines alternative names for taxa Tree -- Defines a tree from MCMC analysis Note that this program supports the use of the shortest unambiguous spelling of the above commands (e.g., "exe" instead of "execute").
Installation
Source downloaded from BEST website.
System
64-bit Linux